matlab r2020 software Search Results


97
Welcony all-mentions
All Mentions, supplied by Welcony, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/all-mentions/product/Welcony
Average 97 stars, based on 1 article reviews
all-mentions - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

90
OriginLab corp originpro 2019b
Originpro 2019b, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/originpro 2019b/product/OriginLab corp
Average 90 stars, based on 1 article reviews
originpro 2019b - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism® 9
Graphpad Prism® 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/graphpad prism® 9/product/GraphPad Software Inc
Average 90 stars, based on 1 article reviews
graphpad prism® 9 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
TA Instruments trios software version 4.1
Trios Software Version 4.1, supplied by TA Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trios software version 4.1/product/TA Instruments
Average 90 stars, based on 1 article reviews
trios software version 4.1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Bruker Corporation bruker topspin 4 0 2 software
Bruker Topspin 4 0 2 Software, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bruker topspin 4 0 2 software/product/Bruker Corporation
Average 96 stars, based on 1 article reviews
bruker topspin 4 0 2 software - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
BIOPAC acqknowledge software version 5.0
Acqknowledge Software Version 5.0, supplied by BIOPAC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acqknowledge software version 5.0/product/BIOPAC
Average 90 stars, based on 1 article reviews
acqknowledge software version 5.0 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Broad Institute Inc cellprofiler software version 3.1.9
Cellprofiler Software Version 3.1.9, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cellprofiler software version 3.1.9/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
cellprofiler software version 3.1.9 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
FLIR Systems flir® atlas sdk
Flir® Atlas Sdk, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flir® atlas sdk/product/FLIR Systems
Average 90 stars, based on 1 article reviews
flir® atlas sdk - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

95
MathWorks Inc image acquisition toolbox
Image Acquisition Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/image acquisition toolbox/product/MathWorks Inc
Average 95 stars, based on 1 article reviews
image acquisition toolbox - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

90
Jackson Laboratory primer srf-flox forward tgcttactggaaagctcatgg
Primer Srf Flox Forward Tgcttactggaaagctcatgg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer srf-flox forward tgcttactggaaagctcatgg/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
primer srf-flox forward tgcttactggaaagctcatgg - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Jackson Laboratory primer srf-flox reverse tgctggtttggcatcaact
Primer Srf Flox Reverse Tgctggtttggcatcaact, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer srf-flox reverse tgctggtttggcatcaact/product/Jackson Laboratory
Average 90 stars, based on 1 article reviews
primer srf-flox reverse tgctggtttggcatcaact - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
10X Genomics cellranger
Cellranger, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cellranger/product/10X Genomics
Average 90 stars, based on 1 article reviews
cellranger - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results