97
|
Welcony
all-mentions All Mentions, supplied by Welcony, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/all-mentions/product/Welcony Average 97 stars, based on 1 article reviews
all-mentions - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
90
|
OriginLab corp
originpro 2019b Originpro 2019b, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/originpro 2019b/product/OriginLab corp Average 90 stars, based on 1 article reviews
originpro 2019b - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
GraphPad Software Inc
graphpad prism® 9 Graphpad Prism® 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/graphpad prism® 9/product/GraphPad Software Inc Average 90 stars, based on 1 article reviews
graphpad prism® 9 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
TA Instruments
trios software version 4.1 Trios Software Version 4.1, supplied by TA Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/trios software version 4.1/product/TA Instruments Average 90 stars, based on 1 article reviews
trios software version 4.1 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
96
|
Bruker Corporation
bruker topspin 4 0 2 software Bruker Topspin 4 0 2 Software, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bruker topspin 4 0 2 software/product/Bruker Corporation Average 96 stars, based on 1 article reviews
bruker topspin 4 0 2 software - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
90
|
BIOPAC
acqknowledge software version 5.0 Acqknowledge Software Version 5.0, supplied by BIOPAC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/acqknowledge software version 5.0/product/BIOPAC Average 90 stars, based on 1 article reviews
acqknowledge software version 5.0 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
cellprofiler software version 3.1.9 Cellprofiler Software Version 3.1.9, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cellprofiler software version 3.1.9/product/Broad Institute Inc Average 90 stars, based on 1 article reviews
cellprofiler software version 3.1.9 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
FLIR Systems
flir® atlas sdk Flir® Atlas Sdk, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flir® atlas sdk/product/FLIR Systems Average 90 stars, based on 1 article reviews
flir® atlas sdk - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
95
|
MathWorks Inc
image acquisition toolbox Image Acquisition Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/image acquisition toolbox/product/MathWorks Inc Average 95 stars, based on 1 article reviews
image acquisition toolbox - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
primer srf-flox forward tgcttactggaaagctcatgg Primer Srf Flox Forward Tgcttactggaaagctcatgg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer srf-flox forward tgcttactggaaagctcatgg/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
primer srf-flox forward tgcttactggaaagctcatgg - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
Jackson Laboratory
primer srf-flox reverse tgctggtttggcatcaact Primer Srf Flox Reverse Tgctggtttggcatcaact, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer srf-flox reverse tgctggtttggcatcaact/product/Jackson Laboratory Average 90 stars, based on 1 article reviews
primer srf-flox reverse tgctggtttggcatcaact - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
90
|
10X Genomics
cellranger Cellranger, supplied by 10X Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cellranger/product/10X Genomics Average 90 stars, based on 1 article reviews
cellranger - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |