matlab r2020 software Search Results


99
Welcony all-mentions
All Mentions, supplied by Welcony, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/welcony___all-mentions?v=Welcony
Average 99 stars, based on 1 article reviews
all-mentions - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
OriginLab corp originpro 2019b
Originpro 2019b, supplied by OriginLab corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm37883688-238-11-13?v=OriginLab+corp
Average 90 stars, based on 1 article reviews
originpro 2019b - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GraphPad Software Inc graphpad prism® 9
Graphpad Prism® 9, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pmc10686989__41467_2023_43694_MOESM4_ESM-14-0-0?v=GraphPad+Software+Inc
Average 90 stars, based on 1 article reviews
graphpad prism® 9 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TA Instruments trios software version 4.1
Trios Software Version 4.1, supplied by TA Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pmc08983462-148-4-8?v=TA+Instruments
Average 90 stars, based on 1 article reviews
trios software version 4.1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

96
Bruker Corporation topspin 4 0 2 software
Topspin 4 0 2 Software, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/10__1002_slash_adom__202101945-215-6-5?v=Bruker+Corporation
Average 96 stars, based on 1 article reviews
topspin 4 0 2 software - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

90
Broad Institute Inc cellprofiler software version 3.1.9
Cellprofiler Software Version 3.1.9, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm33823582-150-1-5?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
cellprofiler software version 3.1.9 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
BIOPAC acqknowledge software version 5.0
Acqknowledge Software Version 5.0, supplied by BIOPAC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm37078023-84-6-10?v=BIOPAC
Average 90 stars, based on 1 article reviews
acqknowledge software version 5.0 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
FLIR Systems flir® atlas sdk
Flir® Atlas Sdk, supplied by FLIR Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/10__1080_slash_09712119__2023__2176310-51-14-17?v=FLIR+Systems
Average 90 stars, based on 1 article reviews
flir® atlas sdk - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

95
MathWorks Inc image acquisition toolbox
Image Acquisition Toolbox, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/10__1016_slash_j__softx__2024__101870-7-74-77?v=MathWorks+Inc
Average 95 stars, based on 1 article reviews
image acquisition toolbox - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

86
Jackson Laboratory tbx4
Figure 1. Deleting Srf from the embryonic pulmonary mesenchyme leads to loss of aSMA but does not affect epithelial branching (A and B) E12.5 <t>Tbx4-rtTA;tet-O-Cre;Srffl/fland</t> littermate control lungs immunostained for Ecad and aSMA. Scale bars, 100 mm. (C) Number of branches in E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs, connected by gray lines and compared using a t test. Inset shows branch number in mutant lungs divided by that of littermate controls, compared with a hypothetical mean of 1, using a one sample t test. Error bars show SD. (D) Airway diameter measured between the first two domain branches of the left lobe of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fllungs and controls (n = 12 controls, 9 mutants). (E) Bright-field images of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs cultured ex vivo. Scale bars, 200 mm. (F) Contours of the epithelium showing dynamic changes in the morphology of terminal bifurcations in mutants and controls. Scale bars, 50 mm. (G) Number of spontaneous smooth muscle contractions per 5-min time lapse in Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs (n = 3 controls, 5 mutants). Error bars show SD. Groups were compared using two-sided t test.
Tbx4, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm36868232-126-6-16?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
tbx4 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Par Pharmaceutical buprenorphine
Figure 1. Deleting Srf from the embryonic pulmonary mesenchyme leads to loss of aSMA but does not affect epithelial branching (A and B) E12.5 <t>Tbx4-rtTA;tet-O-Cre;Srffl/fland</t> littermate control lungs immunostained for Ecad and aSMA. Scale bars, 100 mm. (C) Number of branches in E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs, connected by gray lines and compared using a t test. Inset shows branch number in mutant lungs divided by that of littermate controls, compared with a hypothetical mean of 1, using a one sample t test. Error bars show SD. (D) Airway diameter measured between the first two domain branches of the left lobe of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fllungs and controls (n = 12 controls, 9 mutants). (E) Bright-field images of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs cultured ex vivo. Scale bars, 200 mm. (F) Contours of the epithelium showing dynamic changes in the morphology of terminal bifurcations in mutants and controls. Scale bars, 50 mm. (G) Number of spontaneous smooth muscle contractions per 5-min time lapse in Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs (n = 3 controls, 5 mutants). Error bars show SD. Groups were compared using two-sided t test.
Buprenorphine, supplied by Par Pharmaceutical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm38127625-89-30-38?v=Par+Pharmaceutical
Average 90 stars, based on 1 article reviews
buprenorphine - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Basler pylon viewer
Figure 1. Deleting Srf from the embryonic pulmonary mesenchyme leads to loss of aSMA but does not affect epithelial branching (A and B) E12.5 <t>Tbx4-rtTA;tet-O-Cre;Srffl/fland</t> littermate control lungs immunostained for Ecad and aSMA. Scale bars, 100 mm. (C) Number of branches in E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs, connected by gray lines and compared using a t test. Inset shows branch number in mutant lungs divided by that of littermate controls, compared with a hypothetical mean of 1, using a one sample t test. Error bars show SD. (D) Airway diameter measured between the first two domain branches of the left lobe of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fllungs and controls (n = 12 controls, 9 mutants). (E) Bright-field images of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs cultured ex vivo. Scale bars, 200 mm. (F) Contours of the epithelium showing dynamic changes in the morphology of terminal bifurcations in mutants and controls. Scale bars, 50 mm. (G) Number of spontaneous smooth muscle contractions per 5-min time lapse in Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs (n = 3 controls, 5 mutants). Error bars show SD. Groups were compared using two-sided t test.
Pylon Viewer, supplied by Basler, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/matlab+r2020+software/pm38127625-89-93-90?v=Basler
Average 90 stars, based on 1 article reviews
pylon viewer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


Figure 1. Deleting Srf from the embryonic pulmonary mesenchyme leads to loss of aSMA but does not affect epithelial branching (A and B) E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs immunostained for Ecad and aSMA. Scale bars, 100 mm. (C) Number of branches in E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs, connected by gray lines and compared using a t test. Inset shows branch number in mutant lungs divided by that of littermate controls, compared with a hypothetical mean of 1, using a one sample t test. Error bars show SD. (D) Airway diameter measured between the first two domain branches of the left lobe of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fllungs and controls (n = 12 controls, 9 mutants). (E) Bright-field images of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs cultured ex vivo. Scale bars, 200 mm. (F) Contours of the epithelium showing dynamic changes in the morphology of terminal bifurcations in mutants and controls. Scale bars, 50 mm. (G) Number of spontaneous smooth muscle contractions per 5-min time lapse in Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs (n = 3 controls, 5 mutants). Error bars show SD. Groups were compared using two-sided t test.

Journal: Developmental cell

Article Title: Plasticity in airway smooth muscle differentiation during mouse lung development.

doi: 10.1016/j.devcel.2023.02.002

Figure Lengend Snippet: Figure 1. Deleting Srf from the embryonic pulmonary mesenchyme leads to loss of aSMA but does not affect epithelial branching (A and B) E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs immunostained for Ecad and aSMA. Scale bars, 100 mm. (C) Number of branches in E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs, connected by gray lines and compared using a t test. Inset shows branch number in mutant lungs divided by that of littermate controls, compared with a hypothetical mean of 1, using a one sample t test. Error bars show SD. (D) Airway diameter measured between the first two domain branches of the left lobe of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fllungs and controls (n = 12 controls, 9 mutants). (E) Bright-field images of E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs cultured ex vivo. Scale bars, 200 mm. (F) Contours of the epithelium showing dynamic changes in the morphology of terminal bifurcations in mutants and controls. Scale bars, 50 mm. (G) Number of spontaneous smooth muscle contractions per 5-min time lapse in Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs (n = 3 controls, 5 mutants). Error bars show SD. Groups were compared using two-sided t test.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer: Tbx4, Reverse: ACGCGTCGACACTTAGT TACCCGGGGAGCATG Zhangetal.25 N/A Primer: SRF-flox, Forward: TGCTTACTGGAAAGCTCATGG The Jackson Laboratory Primer no. oIMR6490 Primer: SRF-flox, Reverse: TGCTGGTTTGGCATCAACT The Jackson Laboratory Primer no. oIMR6491 Software and algorithms ImageJ Schneideretal.37 https://imagej.nih.gov/ij/ MATLAB MathWorks N/A CellRanger 10X Genomics Version 3.0.2 R R Foundation for Statistical Computing N/A Seurat Butleretal.38 https://satijalab.org/seurat/ Destiny Haghverdietal.31 https://www.bioconductor.org/ packages/release/bioc/html/ destiny.html Other Opal Polaris 480 Reagent Pack Akoya Biosciences FP1500001KT Opal 520 Reagent Pack Akoya Biosciences FP1487001KT Opal 650 Reagent Pack Akoya Biosciences FP1495001KT RNaseZAP Sigma R2020

Techniques: Control, Mutagenesis, Cell Culture, Ex Vivo

Figure 2. Srf-mutant lungs exhibit normal mesenchymal patterning (A) Schematic illustrating the expected patterns of cytoskeletal elements, tissue mechanical properties, and markers of patterning in the mesenchyme around epithelial tips. (B and C) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Lef1 and counterstained with Hoechst and quantification of Lef1 intensity profiles around epithelial buds (n = 3 controls, 3 mutants). Mean and SD are plotted, and curves were compared using two-way ANOVA. Schematic shows lines and direction along which intensity profiles were measured. Scale bars indicate 50 mm. (D) RNAscope analysis of Acta2 and Bmp4 on sections of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs. Filled arrowheads indicate Bmp4+ sub-epithelial mesenchyme, and empty arrowheads indicate Bmp4+ epithelial tips. Scale bars indicate 50 mm. (E and F) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Tbx3 and counterstained with Hoechst, and quantification of Tbx3 intensity profiles around epithelial tips (n = 3 controls, 3 mutants). Mean and SD are plotted, and curves were compared using two-way ANOVA. Scale bars indicate 50 mm. (G–J) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and F-actin or pMLC, and quantification of F-actin and pMLC intensity profiles around epithelial tips (n = 9 controls, 11 mutants for F-actin; n = 4 controls, 6 mutants for pMLC). Arrowhead indicates enrichment of mesenchymal F-actin and pMLC near the branching epithelium. Scale bars indicate 50 mm. (K) Single confocal slices and reconstructed optical cross-sections through E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and F-actin. Dashed line indicates location of the cross-section. Scale bars indicate 50 mm.

Journal: Developmental cell

Article Title: Plasticity in airway smooth muscle differentiation during mouse lung development.

doi: 10.1016/j.devcel.2023.02.002

Figure Lengend Snippet: Figure 2. Srf-mutant lungs exhibit normal mesenchymal patterning (A) Schematic illustrating the expected patterns of cytoskeletal elements, tissue mechanical properties, and markers of patterning in the mesenchyme around epithelial tips. (B and C) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Lef1 and counterstained with Hoechst and quantification of Lef1 intensity profiles around epithelial buds (n = 3 controls, 3 mutants). Mean and SD are plotted, and curves were compared using two-way ANOVA. Schematic shows lines and direction along which intensity profiles were measured. Scale bars indicate 50 mm. (D) RNAscope analysis of Acta2 and Bmp4 on sections of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs. Filled arrowheads indicate Bmp4+ sub-epithelial mesenchyme, and empty arrowheads indicate Bmp4+ epithelial tips. Scale bars indicate 50 mm. (E and F) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Tbx3 and counterstained with Hoechst, and quantification of Tbx3 intensity profiles around epithelial tips (n = 3 controls, 3 mutants). Mean and SD are plotted, and curves were compared using two-way ANOVA. Scale bars indicate 50 mm. (G–J) E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and F-actin or pMLC, and quantification of F-actin and pMLC intensity profiles around epithelial tips (n = 9 controls, 11 mutants for F-actin; n = 4 controls, 6 mutants for pMLC). Arrowhead indicates enrichment of mesenchymal F-actin and pMLC near the branching epithelium. Scale bars indicate 50 mm. (K) Single confocal slices and reconstructed optical cross-sections through E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and F-actin. Dashed line indicates location of the cross-section. Scale bars indicate 50 mm.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer: Tbx4, Reverse: ACGCGTCGACACTTAGT TACCCGGGGAGCATG Zhangetal.25 N/A Primer: SRF-flox, Forward: TGCTTACTGGAAAGCTCATGG The Jackson Laboratory Primer no. oIMR6490 Primer: SRF-flox, Reverse: TGCTGGTTTGGCATCAACT The Jackson Laboratory Primer no. oIMR6491 Software and algorithms ImageJ Schneideretal.37 https://imagej.nih.gov/ij/ MATLAB MathWorks N/A CellRanger 10X Genomics Version 3.0.2 R R Foundation for Statistical Computing N/A Seurat Butleretal.38 https://satijalab.org/seurat/ Destiny Haghverdietal.31 https://www.bioconductor.org/ packages/release/bioc/html/ destiny.html Other Opal Polaris 480 Reagent Pack Akoya Biosciences FP1500001KT Opal 520 Reagent Pack Akoya Biosciences FP1487001KT Opal 650 Reagent Pack Akoya Biosciences FP1495001KT RNaseZAP Sigma R2020

Techniques: Mutagenesis, Control, RNAscope

Figure 3. scRNA-seq identifies a smooth muscle-like population in Srf-mutant lungs (A) UMAPs of cells isolated from E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs color-coded according to cluster (n = 6 controls, 7 mutants). (B and C) Expression levels of Acta2, Tagln, Srf, and Myocd in mutants and controls. (legend continued on next page)

Journal: Developmental cell

Article Title: Plasticity in airway smooth muscle differentiation during mouse lung development.

doi: 10.1016/j.devcel.2023.02.002

Figure Lengend Snippet: Figure 3. scRNA-seq identifies a smooth muscle-like population in Srf-mutant lungs (A) UMAPs of cells isolated from E12.5 Tbx4-rtTA;tet-O-Cre;Srffl/fland littermate control lungs color-coded according to cluster (n = 6 controls, 7 mutants). (B and C) Expression levels of Acta2, Tagln, Srf, and Myocd in mutants and controls. (legend continued on next page)

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer: Tbx4, Reverse: ACGCGTCGACACTTAGT TACCCGGGGAGCATG Zhangetal.25 N/A Primer: SRF-flox, Forward: TGCTTACTGGAAAGCTCATGG The Jackson Laboratory Primer no. oIMR6490 Primer: SRF-flox, Reverse: TGCTGGTTTGGCATCAACT The Jackson Laboratory Primer no. oIMR6491 Software and algorithms ImageJ Schneideretal.37 https://imagej.nih.gov/ij/ MATLAB MathWorks N/A CellRanger 10X Genomics Version 3.0.2 R R Foundation for Statistical Computing N/A Seurat Butleretal.38 https://satijalab.org/seurat/ Destiny Haghverdietal.31 https://www.bioconductor.org/ packages/release/bioc/html/ destiny.html Other Opal Polaris 480 Reagent Pack Akoya Biosciences FP1500001KT Opal 520 Reagent Pack Akoya Biosciences FP1487001KT Opal 650 Reagent Pack Akoya Biosciences FP1495001KT RNaseZAP Sigma R2020

Techniques: Mutagenesis, Isolation, Control, Expressing

Figure 4. Srf-null airway smooth muscle cells display a phenotype consistent with synthetic smooth muscle (A) Diffusion analysis of mesenchymal cells from the control dataset and projection of Tbx4-rtTA;tet-O-Cre;Srffl/flmutant smooth muscle cells onto the diffusion map. Left plot is color-coded according to clusters from Figure 3A; right plot is color-coded to emphasize control and mutant smooth muscle and cartilage precursors. (B) Clustering of mutant and control smooth muscle cells, based on expression of genes associated with contractile or synthetic smooth muscle phenotype. (C) Single confocal slices and reconstructed optical cross-sections through E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Ecad, aSMA, and Sox9. Dashed line indicates location of the reconstructed cross-section. Scale bars indicate 50 mm. (D) Polar plots showing Sox9 intensity around the airways, based on angle from the center of the bronchus of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs (n = 5 controls, 2 mutants). Line shows mean, and shaded area shows SD. p value is for the comparison of mean intensities using two-sided t test. (E) Thickness of aSMA+ cell layer in controls and Sox9+ cell layer in mutants, compared by t test (n = 7 controls, 4 mutants). (F) RNAscope analysis of Acta2, Myocd, and Col2a1 on sections of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs. Arrowheads indicate Col2a1+ cartilage precursors along lateral side of the primary bronchus. Dashed boxes indicate zoomed-in regions shown to the right. Gray dashed line indicates border between the mesenchyme (mes) and epithelium (ep). Scale bars indicate 50 mm. (G) Single confocal slices of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Ecad and Ki67. Arrowheads point to smooth muscle cells with high Ki67 intensity. Scale bars indicate 50 mm. (H) Quantification of nuclear Ki67 intensity in smooth muscle cells of mutants and controls, compared by t test (n = 3). (I) Single confocal slices of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and Sox9 after a 15-min EdU pulse, focused on the primary bronchus between L.L1 and L.L2. White dashed line indicates border of the epithelium. Arrowheads point to smooth muscle cells with high EdU intensity. Scale bars indicate 50 mm. (J) Quantification of EdU intensity in smooth muscle cells of mutants and controls, compared by t test (n = 3–4). (K) Percentages of control and Tbx4-rtTA;tet-O-Cre;Srffl/flsmooth muscle cells at each phase of the cell cycle, based on scRNA-seq data.

Journal: Developmental cell

Article Title: Plasticity in airway smooth muscle differentiation during mouse lung development.

doi: 10.1016/j.devcel.2023.02.002

Figure Lengend Snippet: Figure 4. Srf-null airway smooth muscle cells display a phenotype consistent with synthetic smooth muscle (A) Diffusion analysis of mesenchymal cells from the control dataset and projection of Tbx4-rtTA;tet-O-Cre;Srffl/flmutant smooth muscle cells onto the diffusion map. Left plot is color-coded according to clusters from Figure 3A; right plot is color-coded to emphasize control and mutant smooth muscle and cartilage precursors. (B) Clustering of mutant and control smooth muscle cells, based on expression of genes associated with contractile or synthetic smooth muscle phenotype. (C) Single confocal slices and reconstructed optical cross-sections through E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Ecad, aSMA, and Sox9. Dashed line indicates location of the reconstructed cross-section. Scale bars indicate 50 mm. (D) Polar plots showing Sox9 intensity around the airways, based on angle from the center of the bronchus of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs (n = 5 controls, 2 mutants). Line shows mean, and shaded area shows SD. p value is for the comparison of mean intensities using two-sided t test. (E) Thickness of aSMA+ cell layer in controls and Sox9+ cell layer in mutants, compared by t test (n = 7 controls, 4 mutants). (F) RNAscope analysis of Acta2, Myocd, and Col2a1 on sections of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs. Arrowheads indicate Col2a1+ cartilage precursors along lateral side of the primary bronchus. Dashed boxes indicate zoomed-in regions shown to the right. Gray dashed line indicates border between the mesenchyme (mes) and epithelium (ep). Scale bars indicate 50 mm. (G) Single confocal slices of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for Ecad and Ki67. Arrowheads point to smooth muscle cells with high Ki67 intensity. Scale bars indicate 50 mm. (H) Quantification of nuclear Ki67 intensity in smooth muscle cells of mutants and controls, compared by t test (n = 3). (I) Single confocal slices of E12.5 control and Tbx4-rtTA;tet-O-Cre;Srffl/fllungs immunostained for aSMA and Sox9 after a 15-min EdU pulse, focused on the primary bronchus between L.L1 and L.L2. White dashed line indicates border of the epithelium. Arrowheads point to smooth muscle cells with high EdU intensity. Scale bars indicate 50 mm. (J) Quantification of EdU intensity in smooth muscle cells of mutants and controls, compared by t test (n = 3–4). (K) Percentages of control and Tbx4-rtTA;tet-O-Cre;Srffl/flsmooth muscle cells at each phase of the cell cycle, based on scRNA-seq data.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer: Tbx4, Reverse: ACGCGTCGACACTTAGT TACCCGGGGAGCATG Zhangetal.25 N/A Primer: SRF-flox, Forward: TGCTTACTGGAAAGCTCATGG The Jackson Laboratory Primer no. oIMR6490 Primer: SRF-flox, Reverse: TGCTGGTTTGGCATCAACT The Jackson Laboratory Primer no. oIMR6491 Software and algorithms ImageJ Schneideretal.37 https://imagej.nih.gov/ij/ MATLAB MathWorks N/A CellRanger 10X Genomics Version 3.0.2 R R Foundation for Statistical Computing N/A Seurat Butleretal.38 https://satijalab.org/seurat/ Destiny Haghverdietal.31 https://www.bioconductor.org/ packages/release/bioc/html/ destiny.html Other Opal Polaris 480 Reagent Pack Akoya Biosciences FP1500001KT Opal 520 Reagent Pack Akoya Biosciences FP1487001KT Opal 650 Reagent Pack Akoya Biosciences FP1495001KT RNaseZAP Sigma R2020

Techniques: Diffusion-based Assay, Control, Mutagenesis, Expressing, Comparison, RNAscope